source code
/* The Computer Language Benchmarks Game
http://benchmarksgame.alioth.debian.org/
contributed by Isaac Gouy
optimizations by Alp Toker <alp@atoker.com>
*/
using System;
using System.IO;
using System.Text;
class Fasta
{
static void Main (string[] args) {
MakeCumulative (HomoSapiens);
MakeCumulative (IUB);
int n = args.Length > 0 ? Int32.Parse (args[0]) : 1000;
using (Stream s = Console.OpenStandardOutput ()) {
MakeRepeatFasta ("ONE", "Homo sapiens alu", Encoding.ASCII.GetBytes (ALU), n*2, s);
MakeRandomFasta ("TWO", "IUB ambiguity codes", IUB, n*3, s);
MakeRandomFasta ("THREE", "Homo sapiens frequency", HomoSapiens, n*5, s);
}
}
// The usual pseudo-random number generator
const int IM = 139968;
const int IA = 3877;
const int IC = 29573;
static int seed = 42;
static double random (double max)
{
return max * ((seed = (seed * IA + IC) % IM) * (1.0 / IM));
}
// Weighted selection from alphabet
static string ALU =
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
class Frequency {
public byte c;
public double p;
public Frequency (char c, double p) {
this.c = (byte)c;
this.p = p;
}
}
static Frequency[] IUB = {
new Frequency ('a', 0.27)
,new Frequency ('c', 0.12)
,new Frequency ('g', 0.12)
,new Frequency ('t', 0.27)
,new Frequency ('B', 0.02)
,new Frequency ('D', 0.02)
,new Frequency ('H', 0.02)
,new Frequency ('K', 0.02)
,new Frequency ('M', 0.02)
,new Frequency ('N', 0.02)
,new Frequency ('R', 0.02)
,new Frequency ('S', 0.02)
,new Frequency ('V', 0.02)
,new Frequency ('W', 0.02)
,new Frequency ('Y', 0.02)
};
static Frequency[] HomoSapiens = {
new Frequency ('a', 0.3029549426680)
,new Frequency ('c', 0.1979883004921)
,new Frequency ('g', 0.1975473066391)
,new Frequency ('t', 0.3015094502008)
};
static void MakeCumulative (Frequency[] a) {
double cp = 0.0;
for (int i=0; i < a.Length; i++) {
cp += a[i].p;
a[i].p = cp;
}
}
// naive
static byte SelectRandom (Frequency[] a) {
double r = random (1.0);
for (int i=0 ; i < a.Length ; i++)
if (r < a[i].p)
return a[i].c;
return a[a.Length-1].c;
}
const int LineLength = 60;
static int index = 0;
static byte[] buf = new byte[1024];
static void MakeRandomFasta (string id, string desc, Frequency[] a, int n, Stream s) {
index = 0;
int m = 0;
byte[] descStr = Encoding.ASCII.GetBytes (">" + id + " " + desc + "\n");
s.Write (descStr, 0, descStr.Length);
while (n > 0) {
m = n < LineLength ? n : LineLength;
if (buf.Length - index < m) {
s.Write (buf, 0, index);
index = 0;
}
for (int i = 0 ; i < m ; i++) {
buf[index++] = SelectRandom (a);
}
buf[index++] = (byte)'\n';
n -= LineLength;
}
if (index != 0)
s.Write (buf, 0, index);
}
static void MakeRepeatFasta (string id, string desc, byte[] alu, int n, Stream s) {
index = 0;
int m = 0;
int k = 0;
int kn = alu.Length;
byte[] descStr = Encoding.ASCII.GetBytes (">" + id + " " + desc + "\n");
s.Write (descStr, 0, descStr.Length);
while (n > 0) {
m = n < LineLength ? n : LineLength;
if (buf.Length - index < m) {
s.Write (buf, 0, index);
index = 0;
}
for (int i = 0; i < m ; i++) {
if (k == kn)
k = 0;
buf[index++] = alu[k];
k++;
}
buf[index++] = (byte)'\n';
n -= LineLength;
}
if (index != 0)
s.Write (buf, 0, index);
}
}