source code
/* The Computer Language Benchmarks Game
* http://benchmarksgame.alioth.debian.org/
*
* contributed by The Go Authors.
* Based on C program by Joern Inge Vestgaarden
* and Jorge Peixoto de Morais Neto.
* flag.Arg hack by Isaac Gouy
* parallel hack by INADA Naoki
*/
package main
import (
"bufio"
"flag"
"os"
"runtime"
"strconv"
)
var out *bufio.Writer
const WIDTH = 60 // Fold lines after WIDTH bytes
func min(a, b int) int {
if a < b {
return a
}
return b
}
type AminoAcid struct {
p float64
c byte
}
func AccumulateProbabilities(genelist []AminoAcid) {
for i := 1; i < len(genelist); i++ {
genelist[i].p += genelist[i-1].p
}
}
// RepeatFasta prints the characters of the byte slice s. When it
// reaches the end of the slice, it goes back to the beginning.
// It stops after generating count characters.
// After each WIDTH characters it prints a newline.
// It assumes that WIDTH <= len(s) + 1.
func RepeatFasta(s []byte, count int) {
pos := 0
s2 := make([]byte, len(s)+WIDTH)
copy(s2, s)
copy(s2[len(s):], s)
for count > 0 {
line := min(WIDTH, count)
out.Write(s2[pos : pos+line])
out.WriteByte('\n')
pos += line
if pos >= len(s) {
pos -= len(s)
}
count -= line
}
}
const (
IM = 139968
IA = 3877
IC = 29573
)
var lastrandom uint32 = 42
func generateRandom(buf []float64) {
for i := 0; i < len(buf); i++ {
lastrandom = (lastrandom*IA + IC) % IM
buf[i] = float64(lastrandom) / IM
}
}
// generateDna generates DNA text from random sequence.
// Each element of genelist is a struct with a character and
// a floating point number p between 0 and 1.
// generateDna takes a random float r and
// finds the first element such that p >= r.
// This is a weighted random selection.
func generateDna(genelist []AminoAcid, rb []float64, wb []byte) int {
count := len(rb)
i := 0
o := 0
for count > 0 {
line := min(WIDTH, count)
count -= line
for j := 0; j < line; j++ {
r := rb[i]
for _, v := range genelist {
if v.p >= r {
wb[o] = v.c
break
}
}
i++
o++
}
wb[o] = '\n'
o++
}
return o
}
const (
RANDOM_BUF_SIZE = WIDTH * 1000
OUT_BUF_SIZE = (WIDTH + 1) * 1000
// 1 for output, 4 for generateDna, 1 for generateRandom and 2 spaces
SLOT = 8
)
// RandomFasta then prints the character of the array element.
// This sequence is repeated count times.
// Between each WIDTH consecutive characters, the function prints a newline.
func RandomFasta(genelist []AminoAcid, count int) {
rbufs := make([][]float64, SLOT)
wbufs := make([][]byte, SLOT)
for i := 0; i < SLOT; i++ {
rbufs[i] = make([]float64, RANDOM_BUF_SIZE)
wbufs[i] = make([]byte, OUT_BUF_SIZE)
}
// Use `chan []byte` as future object. och is queue of future.
och := make(chan chan []byte, 4)
done := make(chan bool)
go func() {
for bc := range och {
buf := <-bc
out.Write(buf)
}
done <- true
}()
for i := 0; count > 0; i++ {
chunk := min(count, RANDOM_BUF_SIZE)
count -= chunk
rb := rbufs[i%SLOT][:chunk]
wb := wbufs[i%SLOT]
generateRandom(rb)
c := make(chan []byte)
och <- c
go func(rb []float64, wb []byte, c chan []byte) {
o := generateDna(genelist, rb, wb)
c <- wb[:o]
}(rb, wb, c)
}
close(och)
<-done
}
func main() {
runtime.GOMAXPROCS(runtime.NumCPU())
out = bufio.NewWriter(os.Stdout)
defer out.Flush()
n := 0
flag.Parse()
if flag.NArg() > 0 {
n, _ = strconv.Atoi(flag.Arg(0))
}
iub := []AminoAcid{
AminoAcid{0.27, 'a'},
AminoAcid{0.12, 'c'},
AminoAcid{0.12, 'g'},
AminoAcid{0.27, 't'},
AminoAcid{0.02, 'B'},
AminoAcid{0.02, 'D'},
AminoAcid{0.02, 'H'},
AminoAcid{0.02, 'K'},
AminoAcid{0.02, 'M'},
AminoAcid{0.02, 'N'},
AminoAcid{0.02, 'R'},
AminoAcid{0.02, 'S'},
AminoAcid{0.02, 'V'},
AminoAcid{0.02, 'W'},
AminoAcid{0.02, 'Y'},
}
homosapiens := []AminoAcid{
AminoAcid{0.3029549426680, 'a'},
AminoAcid{0.1979883004921, 'c'},
AminoAcid{0.1975473066391, 'g'},
AminoAcid{0.3015094502008, 't'},
}
AccumulateProbabilities(iub)
AccumulateProbabilities(homosapiens)
alu := []byte(
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
out.WriteString(">ONE Homo sapiens alu\n")
RepeatFasta(alu, 2*n)
out.WriteString(">TWO IUB ambiguity codes\n")
RandomFasta(iub, 3*n)
out.WriteString(">THREE Homo sapiens frequency\n")
RandomFasta(homosapiens, 5*n)
}