source code
/* The Computer Language Benchmarks Game
http://benchmarksgame.alioth.debian.org/
converted to C++ from D by Rafal Rusin
modified by Vaclav Haisman
modified by The Anh to compile with g++ 4.3.2
modified by Branimir Maksimovic
*/
#include <cstdio>
#include <cstdlib>
#include <cstring>
#include <algorithm>
#include <vector>
#include <numeric>
static int const IM = 139968, IA = 3877, IC = 29573;
static int last = 42;
static inline
float
genRandom(float max)
{
return(max * (last = (last * IA + IC) % IM) / IM);
}
struct IUB
{
char c;
float p;
};
static inline
void
makeCumulative(std::vector<IUB>& i)
{
std::partial_sum (i.begin(), i.end(), i.begin(),
[](IUB l,IUB r)->IUB{r.p+=l.p;return r;});
}
static const char alu[] =
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
static const unsigned length = 60;
template <class F>
static inline
void
make(char const * id, char const * desc, unsigned n, F f)
{
printf(">%s %s\n", id, desc);
char line[length+1]={0};
unsigned i = 0;
while(n-- > 0)
{
line[i++]=f();
if(i >= length)
{
puts(line);
i = 0;
}
}
line[i] = 0;
if(strlen(line))puts(line);
}
struct Repeat{
Repeat(const char* alu):i(0),size(strlen(alu)),alu(alu){}
char operator()()
{
if(i >= size)i=0;
return alu[i++];
}
unsigned i,size;
const char* alu;
};
struct Random{
Random(std::vector<IUB>& i):i(i){}
char operator()()
{
float p = genRandom(1.0);
return i[std::count_if(i.begin(),i.end(),
[p](IUB i){ return p>=i.p;})].c;
}
std::vector<IUB>& i;
};
static std::vector<IUB> iub =
{
{ 'a', 0.27 },
{ 'c', 0.12 },
{ 'g', 0.12 },
{ 't', 0.27 },
{ 'B', 0.02 },
{ 'D', 0.02 },
{ 'H', 0.02 },
{ 'K', 0.02 },
{ 'M', 0.02 },
{ 'N', 0.02 },
{ 'R', 0.02 },
{ 'S', 0.02 },
{ 'V', 0.02 },
{ 'W', 0.02 },
{ 'Y', 0.02 }
};
static std::vector<IUB> homosapiens =
{
{ 'a', 0.3029549426680 },
{ 'c', 0.1979883004921 },
{ 'g', 0.1975473066391 },
{ 't', 0.3015094502008 }
};
int main(int argc, char *argv[])
{
unsigned const n = argc > 1 ? atoi(argv[1]) : 1;
makeCumulative(iub);
makeCumulative(homosapiens);
make("ONE", "Homo sapiens alu", n*2,Repeat(alu));
make("TWO", "IUB ambiguity codes", n*3, Random(iub));
make("THREE", "Homo sapiens frequency", n*5, Random(homosapiens));
}