source code
/* The Computer Language Benchmarks Game
http://benchmarksgame.alioth.debian.org/
converted to C++ from D by Rafal Rusin
modified by Vaclav Haisman
modified by The Anh to compile with g++ 4.3.2
modified by Branimir Maksimovic
modified by Kim Walisch
modified by Tavis Bohne
compiles with gcc fasta.cpp -std=c++11 -O2
*/
#include <algorithm>
#include <array>
#include <iostream>
#include <numeric>
struct IUB
{
float p;
char c;
};
std::array<char, 288> alu =
{
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG"
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA"
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT"
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA"
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG"
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC"
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"
};
std::array<IUB,15> iub =
{{
{ 0.27f, 'a' },
{ 0.12f, 'c' },
{ 0.12f, 'g' },
{ 0.27f, 't' },
{ 0.02f, 'B' },
{ 0.02f, 'D' },
{ 0.02f, 'H' },
{ 0.02f, 'K' },
{ 0.02f, 'M' },
{ 0.02f, 'N' },
{ 0.02f, 'R' },
{ 0.02f, 'S' },
{ 0.02f, 'V' },
{ 0.02f, 'W' },
{ 0.02f, 'Y' }
}};
std::array<IUB, 4> homosapiens =
{{
{ 0.3029549426680f, 'a' },
{ 0.1979883004921f, 'c' },
{ 0.1975473066391f, 'g' },
{ 0.3015094502008f, 't' }
}};
float gen_random(float max = 1.0f)
{
static const int IM = 139968, IA = 3877, IC = 29573;
static int last = 42;
last = (last * IA + IC) % IM;
return max * last * (1.0f / IM);
}
template<class iterator_type>
class repeat_functor_type {
public:
repeat_functor_type(iterator_type first, iterator_type last)
: first(first), current(first), last(last)
{ }
char operator()()
{
if (current == last)
current = first;
iterator_type p = current;
++current;
return *p;
}
private:
iterator_type first;
iterator_type current;
iterator_type last;
};
template<class iterator_type>
repeat_functor_type<iterator_type>
make_repeat_functor(iterator_type first, iterator_type last)
{return repeat_functor_type<iterator_type>(first, last);}
template<class iterator_type>
class random_functor_type {
public:
random_functor_type(iterator_type first, iterator_type last)
: first(first), last(last)
{ }
char operator()()
{
const float p = gen_random(1.0f);
auto result = std::find_if(first, last, [p] (IUB i) { return p <= i.p; });
return result->c;
}
private:
iterator_type first;
iterator_type last;
};
template<class iterator_type>
random_functor_type<iterator_type>
make_random_functor(iterator_type first, iterator_type last)
{return random_functor_type<iterator_type>(first, last);}
template<class iterator_type>
void make_cumulative(iterator_type first, iterator_type last)
{
std::partial_sum(first, last, first,
[] (IUB l, IUB r) -> IUB { r.p += l.p; return r; });
}
template <class F>
void make(const char* desc, int n, F functor)
{
std::cout << '>' << desc << '\n';
const int MAXLINE = 60;
char line[MAXLINE + 1];
while (n > 0)
{
int thisline = n;
if (thisline > MAXLINE)
thisline = MAXLINE;
for(int i=0; i<thisline; ++i)
line[i] = functor();
line[thisline] = '\n';
std::cout.write(line, thisline+1);
n -= thisline;
}
}
int main(int argc, char *argv[])
{
int n = 1000;
if (argc < 2 || (n = std::atoi(argv[1])) <= 0) {
std::cerr << "usage: " << argv[0] << " length\n";
return 1;
}
std::cout.sync_with_stdio(false);
make_cumulative(iub.begin(), iub.end());
make_cumulative(homosapiens.begin(), homosapiens.end());
//alu must drop the trailing zero stuck on by string literals :(
make("ONE Homo sapiens alu" , n * 2,
make_repeat_functor(alu.begin(), alu.end()-1));
make("TWO IUB ambiguity codes" , n * 3,
make_random_functor(iub.begin(), iub.end()));
make("THREE Homo sapiens frequency", n * 5,
make_random_functor(homosapiens.begin(), homosapiens.end()));
return 0;
}