source code
<?php
/* The Computer Language Benchmarks Game
http://benchmarksgame.alioth.debian.org/
contributed by Wing-Chung Leung
modified by Isaac Gouy
modified by anon
*/
ob_implicit_flush(1);
ob_start(NULL, 4096);
$last = 42.0;
function gen_random(&$last, &$randoms, $max = 1.0, $ia = 3877.0, $ic = 29573.0, $im = 139968.0) {
foreach($randoms as &$r) {
$r = $max * ($last = ($last * $ia + $ic) % $im) / $im;
}
}
/* Weighted selection from alphabet */
function makeCumulative(&$genelist) {
$cumul = 0.0;
foreach($genelist as $k=>&$v) {
$cumul = $v += $cumul;
}
}
/* Generate and write FASTA format */
function makeRandomFasta(&$genelist, $n) {
$width = 60;
$lines = (int) ($n / $width);
$pick = str_repeat('?', $width)."\n";
$randoms = array_fill(0, $width, 0.0);
global $last;
// full lines
for ($i = 0; $i < $lines; ++$i) {
gen_random($last, $randoms);
$j = 0;
foreach ($randoms as $r) {
foreach($genelist as $k=>$v) {
if ($r < $v) {
break;
}
}
$pick[$j++] = $k;
}
echo $pick;
}
// last, partial line
$w = $n % $width;
if ($w !== 0) {
$randoms = array_fill(0, $w, 0.0);
gen_random($last, $randoms);
$j = 0;
foreach ($randoms as $r) {
foreach($genelist as $k=>$v) {
if ($r < $v) {
break;
}
}
$pick[$j++] = $k;
}
$pick[$w] = "\n";
echo substr($pick, 0, $w+1);
}
}
function makeRepeatFasta($s, $n) {
$i = 0; $sLength = strlen($s); $lineLength = 60;
while ($n > 0) {
if ($n < $lineLength) $lineLength = $n;
if ($i + $lineLength < $sLength){
print(substr($s,$i,$lineLength)); print("\n");
$i += $lineLength;
} else {
print(substr($s,$i));
$i = $lineLength - ($sLength - $i);
print(substr($s,0,$i)); print("\n");
}
$n -= $lineLength;
}
}
/* Main -- define alphabets, make 3 fragments */
$iub=array(
'a' => 0.27,
'c' => 0.12,
'g' => 0.12,
't' => 0.27,
'B' => 0.02,
'D' => 0.02,
'H' => 0.02,
'K' => 0.02,
'M' => 0.02,
'N' => 0.02,
'R' => 0.02,
'S' => 0.02,
'V' => 0.02,
'W' => 0.02,
'Y' => 0.02
);
$homosapiens = array(
'a' => 0.3029549426680,
'c' => 0.1979883004921,
'g' => 0.1975473066391,
't' => 0.3015094502008
);
$alu =
'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG' .
'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA' .
'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT' .
'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA' .
'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG' .
'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC' .
'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA';
$n = 1000;
if ($_SERVER['argc'] > 1) $n = $_SERVER['argv'][1];
makeCumulative($iub);
makeCumulative($homosapiens);
echo ">ONE Homo sapiens alu\n";
makeRepeatFasta($alu, $n*2);
echo ">TWO IUB ambiguity codes\n";
makeRandomFasta($iub, $n*3);
echo ">THREE Homo sapiens frequency\n";
makeRandomFasta($homosapiens, $n*5);