source code
# The Computer Language Benchmarks Game
# http://benchmarksgame.alioth.debian.org/
#
# modified by Ian Osgood
# modified again by Heinrich Acker
# modified by Justin Peel
# modified by Christopher Sean Forgeron
# modified by Josh Goldfoot (repeat-fasta buffering)
import sys
import bisect
import io
alu = (
'GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG'
'GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA'
'CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT'
'ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA'
'GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG'
'AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC'
'AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA')
iub = list(zip('acgtBDHKMNRSVWY', [0.27, 0.12, 0.12, 0.27] + [0.02] * 11))
homosapiens = [
('a', 0.3029549426680),
('c', 0.1979883004921),
('g', 0.1975473066391),
('t', 0.3015094502008),
]
def make_cumulative(table):
P = []
C = []
prob = 0.
for char, p in table:
prob += p
P += [prob]
C += [ord(char)]
return (P, C)
def repeat_fasta_into_buffer(src, n, nprint):
width = 60
is_trailing_line = False
count_modifier = 0.0
len_of_src = len(src)
ss = src + src + src[:n % len_of_src]
# CSF - It's faster to work with a bytearray than a string
s = bytearray(ss, encoding='utf8')
if n % width:
# We don't end on a 60 char wide line
is_trailing_line = True
count_modifier = 1.0
# CSF - Here we are stuck with using an int instead of a float for the loop,
# but testing showed it still to be faster than a for loop
count = 0
end = (n / float(width)) - count_modifier
while count < end:
i = count*60 % len_of_src
nprint(s[i:i+60] + b'\n')
count += 1
if is_trailing_line:
nprint(s[-(n % width):] + b'\n')
def repeat_fasta(src, n):
# JG - Every 287 lines (= length of ALU) repeat-fasta repeats.
# So calculate that once and print it out as many times as we need.
nprint = sys.stdout.buffer.write
sequencebuffer = io.BytesIO()
repeat_fasta_into_buffer(src, len(src) * 60, sequencebuffer.write)
sequence = sequencebuffer.getvalue()
sequencelen = len(sequence)
outbytes = n + (n // 60)
while outbytes >= sequencelen:
nprint(sequence)
outbytes -= sequencelen
nprint(sequence[:outbytes] + b'\n')
def random_fasta(table, n, seed):
width = 60
r = range(width)
bb = bisect.bisect
# If we don't have a multiple of the width, then we will have a trailing
# line, which needs a slightly different approach
is_trailing_line = False
count_modifier = 0.0
# CSF - nprint allows us to print a bytearray directly to stdout, avoiding
# some conversion steps along the way, including a call to join
nprint = sys.stdout.buffer.write
line = bytearray(width + 1) # Width of 60 + 1 for the \n char
probs, chars = make_cumulative(table)
# pRNG Vars
im = 139968.0
#seed = 42.0
if n % width:
# We don't end on a 60 char wide line
is_trailing_line = True
count_modifier = 1.0
# CSF - Loops with a high iteration count run faster as a while/float loop.
count = 0.0
end = (n / float(width)) - count_modifier
while count < end:
# CSF - Low iteration count loops may run faster as a for loop.
for i in r:
# CSF - Python is faster for all float math than it is for int, on my
# machine at least.
seed = (seed * 3877.0 + 29573.0) % 139968.0
# CSF - While real values, not variables are faster for most things, on my
# machine, it's faster to have 'im' already in a var
line[i] = chars[bb(probs, seed / im)]
line[60] = 10 # End of Line
nprint(line)
count += 1.0
if is_trailing_line:
for i in range(n % width):
seed = (seed * 3877.0 + 29573.0) % 139968.0
line[i] = chars[bb(probs, seed / im)]
nprint(line[:i+1] + b"\n")
return seed
def main():
n = int(sys.argv[1])
nprint = sys.stdout.buffer.write
nprint(b'>ONE Homo sapiens alu\n')
repeat_fasta(alu, n * 2)
# We need to keep track of the state of 'seed' so we pass it in, and return
# it back so our output can pass the diff test
nprint(b'>TWO IUB ambiguity codes\n')
seed=random_fasta(iub, n * 3, seed=42.0)
nprint(b'>THREE Homo sapiens frequency\n')
random_fasta(homosapiens, n * 5, seed)
if __name__ == "__main__":
main()